Mack Supersnow x TUG Snow

[blbecker3]

Mack Supersnow x TUG Snow
What are my chances of getting a TUG x Mack Super Snow from this pairing?
THANKS!
Brandon

 

[HugeGenes&LoLa]

50% mack
50% super

0% tug

 

[blbecker3]

thanks!
next question lol,

would that be kind of a muddying the waters sort of thing?

 

[cassadaga]

In my opinion, yes.

 

[HugeGenes&LoLa]

Or 100% super snow. Depending on if the TUG/GEM gene is 1c or 2c. If it's 1c, then it's the first post. 2c then it's this post.

 

[Gazz]

Or 100% super snow. Depending on if the TUG/GEM gene is 1c or 2c. If it's 1c, then it's the first post. 2c then it's this post.

Personally from such a breeding i think that all snow offspring are converted into MAC(Codom snow) and super snow.
I'm baseing this on the fact you get super snow 1st generation.Coz i'd expect the results to be.

MAC Snow X [1C]TUG Snow = .

Normal.
MAC Snow.
[1C]TUG Snow.
------
MAC Snow X [2C]TUG Snow = .

[1C]TUG Snow.
=====
But the fact you get Super snow i think the MAC(Codom snow) gene over ranks the TUG/GEM(Dom snow) gene.
Regardless wheather the TUG/GEM(Dom snow) is [1C] or [2C].

Personally i think it's.

MAC Snow X [1C]TUG Snow = .

Normal.
MAC Snow.
Super snow.
------
MAC Snow X [2C]TUG Snow = .

Normal.
MAC Snow.
Super snow.


Is anyone really going into crossing snows to try and work out what going on ?.

 

[cassadaga]

Are you trying to say that a Super Snow from a TUG x Mack becomes pure Mack? If so, why would you think that?

 

[Gazz]

Are you trying to say that a Super Snow from a TUG x Mack becomes pure Mack? If so, why would you think that?

IMO yes.

Coz.

TUG X TUG = NO Super snow.
GEM X GEM = NO Super snow.
TUG X GEM = NO Super snow.

Yet.

TUG X MAC = Super snow.
GEM X MAC = Super snow.

When i expect.

TUG X MAC = Normal,MAC,TUG.
GEM X MAC = Normal,MAC,GEM.

IMO is the MAC doing all the work.And as a result i think it some how convert the snow offspring.
In some way converts the Dom snow influance into Codom influance.

 

[cassadaga]

So when a TUG X Mack creates a Super Snow, you're saying that the TUG gene just randomly changes into a Mack gene? I doubt that's what is going on, but I guess anything is possible, I don't exactly have a great explanation for it either.

 

[Gazz]

So when a TUG X Mack creates a Super Snow, you're saying that the TUG gene just randomly changes into a Mack gene? I doubt that's what is going on, but I guess anything is possible, I don't exactly have a great explanation for it either.

That what i'm thinking yes some how Dom snow some how converts into Codom snow.

I mean why from two differant snow line do you get Super snow first generation.Why from a Dom snow X Codom snow breeding do you get Normal,?Snow type?,Super snow.When by rights you'd really only expect to get from a Dom snow X Codom snow breeding Normal,Codom snow,Dom snow.

 

[herpencounter]

Nice idea but, no... The TUG snow DNA sequence is not going to magically turn into the Mack DNA sequence. I think I know what is going on. I MIGHT post what I think latter today.

 

[Gazz]

I MIGHT post what I think latter today.

Please do :main_yes:.If you can explain how a leo not geneically carrying the super snow trait.Can out the blue give Super snow offspring when bred to a leo that is carrying the Super snow trait.Wouldn't you class that as magically changeing ?.

 

[BSM]

I'm thinking the same as everyone else so please share your theory on this.


My theory on this is the same but i wounder what would happen if you bred 2 of these SS crosses together? Will you get snows and SS, i know that sounds weird as SS x SS = SS

 

[cassadaga]

Does a TUG X Gem create a Super Snow? Is it proven that they are different? They have very different looks, but that could be from line breeding. Also, does anyone have a proven Homozygous Gem? Or proven homozygous TUG?

A Gem snow gene can not magically turn into the Mack gene. A SS from a Gem X Mack crossing is 1 copy of Gem and 1 copy of Mack making a homozygous.

 

[Gazz]

Does a TUG X Gem create a Super Snow? Is it proven that they are different? They have very different looks, but that could be from line breeding. Also, does anyone have a proven Homozygous Gem? Or proven homozygous TUG?

A Gem snow gene can not magically turn into the Mack gene. A SS from a Gem X Mack crossing is 1 copy of Gem and 1 copy of Mack making a homozygous.

[1C]GEM Snow X [1C]GEM Snow DOESN'T result in Super snow.So in a GEM Snow X MAC Snow there's still only ONE leo carrying the super snow trait.The GEM Snow doesn't carry it or you'd get Super snow from a GEM Snow X GEM Snow breeding.

Your thinking GEM turning into MAC.When in truth it's Dominant converting into Codominant or Dominant converting into Incomplete dominant.So thinking on that term is it really that impossible.

 

[Baoh]

There is no "conversion" or any such nonsense. These sorts of conversations are getting ridiculous.

A decent explanation has been posted at least once before (not by me) and, if you want to learn or understand the concept, it's up to the reader to take the initiative.

 

[herpencounter]

[1C]GEM Snow X [1C]GEM Snow DOESN'T result in Super snow.So in a GEM Snow X MAC Snow there's still only ONE leo carrying the super snow trait.The GEM Snow doesn't carry it or you'd get Super snow from a GEM Snow X GEM Snow breeding.

Your thinking GEM turning into MAC.When in truth it's Dominant converting into Codominant or Dominant converting into Incomplete dominant.So thinking on that term is it really that impossible.

The nucleotide bases A, G, T and, C (adenine, guanine, cytosine, and thymine)

Lets say the DNA sequence for TUG is.
ATGCTTGCATAGCGTGGTAACTCGACGTGCTAGCT

This is the DNA sequence for Macks.
TACTTACGATGTCATGTGTACAACGTACGTAGTGC

Most organisms have a very good "spell checker" when making DNA so this... ATGCTTGCATAGCGTGGTAACTCGACGTGCTAGCT does not become this... TACTTACGATGTCATGTGTACAACGTACGTAGTGC.

 

[herpencounter]

There is no "conversion" or any such nonsense. These sorts of conversations are getting ridiculous.

A decent explanation has been posted at least once before (not by me) and, if you want to learn or understand the concept, it's up to the reader to take the initiative.

Where can I find this? I would like to see it before I post my idea.

 

[LoveGeckos.com]

Oh boy, the TUG/GEM/Mack debate ... lol ... I can see this going in circles, I wish you all the best of luck ... lol

herpencounter - please post you idea/theory as spot on or as far out as it may be, lets hear it. Any ideas thrown in can only be a good thing

Hell .. I may even post my theroies on the test breeding I have done with TUGs over the last few years, although I feel my head may hurt at the end of it.

herpencounter - if your theory are the same as mine, it will just save me from posting

 

[BSM]

I would like to here it as well, my thought was something along the lines regarding to ball python morphs.